Tazswana’s Story by S. Catherine Silver Key

Handout 8—Pre-mRNA/DNA Gene Therapy for Tazswana


Figure

Figure 8-1. Gene Therapy for Tazswana. Alternative splice patterns are shown. Wild-type splicing (dashed line and arrow) results in exon 2 juxtaposed to exon 3. The alternative splice pattern (solid lines and arrow) results in retention of a portion of the intron between exons 2 and 3. Oligonucleotides (10 nt long) can affect alternative splicing of the β-globin pre-mRNA. The β-globin pre-mRNA (top of figure) that causes Tazswana’s β-thalassemia is depicted. The mutation causing the aberrant 5′ splicing sequence is represented by a checkered-box. The cryptic 3′ splicing sequence in the intron is represented by a striped box. The antisense oligonucleotides are represented by polka dot, grey rectangles.

Figure modified from “Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing” Sazani, P. and R. Kole. (2003) The Journal of Clinical Investigation 112(4)481–486.

Questions

  1. What is “alternative splicing” and how does it apply to Tazswana’s case?
  2. Design Tazswana’s gene therapy to force the splicesome into the “normal” alternative splice pattern.
    1. Propose a complementary DNA sequence to interact (hybridize) with Tazswana’s pre-mRNA. Draw the 10 nt DNA oligonucleotide that will complementary base-pair to the pre-mRNA to specifically “mask” the extra 5′ splice site (underlined). Don’t mask the normal splice sites! Assume her intron sequence for the pre-mRNA is as shown here:
      5′GUAAGUCUAAUGUCCCCUCAGAAGAAGGUCACUCUAACGACUCUUCAG3′
    2. Discuss the type of cell the oligonucleotides need to be delivered to in order to affect alternative splicing of the β-globin pre-mRNA.
  3. Recall that splicesomes are composed of snRNA and protein. Explain how hybridization (complementary base-pairing) of the DNA oligonucleotides to the cryptic and aberrant pre-mRNA sequences would correct the splicing defect.
  4. If Tazswana’s 5′ splice site at the correct location (exon2/intron2 boundary) had a point mutation from G to U so that the original 5′ splice site read “UU” instead of “GU,” would the gene therapy correct her β-thalassemia? Explain your answer.
  5. (Optional) Since the oligonucleotides target splice site consensus sequences that are common to all introns, wouldn’t they potentially cause side-effects in many cell types? Discuss within your group and come up with:
    1. Potential side-effects
    2. Plan to limit side-effects.
  6. If you were in Tazswana’s family, would you want Tazswana to undergo gene therapy treatment? Explain why or why not.


Originally published at http://www.sciencecases.org/tazswana/tazswana8.asp

Copyright © 1999–2012 by the National Center for Case Study Teaching in Science.  Please see our usage guidelines, which outline our policy concerning permissible reproduction of this work.