The Case of the “Tainted” Taco Shells
Advanced Biochemistry Edition
by
Ann Taylor
Department of Chemistry
Wabash College
Part II—Project Design
To understand the science behind the use of genetically modified foods, Chris, Michelle, and Mark ask our class to help them. Since there is a lot of material to understand, we will divide into three “interest groups”:
- Entomologists
- Farmers
- Immunologists
Each student in the class will be assigned to an interest group. Each group will read several primary literature papers to understand how transgenic plants are made and the biochemical issues of interest to their constituents and then hand in written answers to the common questions and their group questions.
Each group will also prepare a 15-minute oral presentation to be given in lab. In the oral presentation, you should integrate your written answers into a broader discussion of when or whether genetically modified plants should be used. Your written work will be due at the time of your oral presentation. Following the presentation, there will be an opportunity for questions from the other groups.
Your grade will be 50% for the group written work, 40% for the group presentation, and 10% for your participation in the discussions of the other interest groups.
Common Questions (All groups answer these in their written answers)
Read:
- Pöpping, Bert. “Are you ready for [a] Roundup?” Journal of Chemical Education, June 2001, 78: 752–756.
Then answer the following questions:
- Figure 1 in the article shows a pair of scissors cutting out a gene of interest. What kind of enzyme do the scissors represent? What techniques might you use to confirm that the gene of interest has been inserted into the plasmid (the circular piece of DNA)?
- Besides the gene of interest, what other DNA sequences must be inserted into the plant to make it express a protein of interest?
- Describe the three most common genetic modifications of plants and why each modification has been made.
- Compare and contrast the general ELISA and PCR methods for detecting genetically modified foods. Which method is most commonly used, and why?
- Design 18 bp PCR primers to amplify (and detect!) the following portion of the cauliflower mosaic virus 35S promoter:
gtagtgggattgtgcgtcatcccttacgtcagtgg(110 bases)tcaacgatggcctttcctttatcgcaatgatggcatttgtaggagc
Interest Group Questions (Only answer the questions for your group)
Entomologists
Read:
- Hellmich, Richard L., et al., “Monarch larvae sensitivity to Bacillus thuringiensis-purified proteins and pollen,” Proceedings of the National Academy of Sciences, October 9, 2001; 98 (21): 11925–11930;
- Sears, Mark K., et al., “Impact of Bt corn pollen on monarch butterfly populations: A risk assessment,” Proceedings of the National Academy of Sciences, October 9, 2001; 98 (21): 11937–11942; and
- Aronson, Arthur, et al., “Why Bacillus thuringiensis insecticidal toxins are so effective: unique features of their mode of action,” FEMS Microbiology Letters, Feb. 5, 2001; 195(1): 1–8.
Then answer the following questions:
- What effect did exposure to Bt corn pollen have upon larval survival, leaf consumption, and larval weight?
- An insect is called an instar when it is between two molts. A newly-hatched insect is called a first-instar or larva. An adult is a final instar. Most caterpillars (butterfly and moth larva) have five or six instars. (To see the different instar stages, go to http://www.gpnc.org/monarch.htm.) Does pollen from Bt corn affect all instars equally?
- For Bt corn to be toxic to butterflies, what conditions must be true besides the toxicity of the Cry proteins?
- In one paragraph, describe the biochemical interactions that occur when an insect ingests Bt crystal proteins.
- Describe the three domains of a Cry protein and their putative functions.
- Next, we will investigate the structure of domain I in greater detail. The PDB code for one of the Cry proteins, Cry1Aa, is 1CIY. Open it using Protein Explorer (http://www.proteinexplorer.org; enter 1ciy in the box in the middle column and press “go”).
- Turn off the spinning and hide the water. Can you identify the three domains?
- Click on Explore More!
- Choose “Color N-->C Rainbow.” The N terminus is blue, and the C terminus is red.
- To view just domain I, type “restrict 1-260” in the box on the lower left.
- Center the structure by clicking on the center button, then click somewhere in the middle of the trace of the domain.
Arginines appear to play a key role in the function of domain I. Let’s examine some of these arginine residues more closely.
- Type “Select arg224, arg228, arg233” (no spaces) in the box. The lower box should say “33 atoms selected.”
- Choose Display-->spacefill and Color-->element (cpk). The arginines of interest should now be displayed as balls. Click on each one to determine the residue number for each one (reported in bottom left box). Describe the location of each arginine of interest as in the first example below:
- Arg 93: N terminal end of helix 3
- Arg 224:______________________
- Arg 228:______________________
- Arg 233:______________________
Dean et al. (“Probing the mechanism of action of Bacillus thuringiensis insecticidal proteins by site-directed mutagenesis—A minireview— in Gene 179(1) (1996): 111–117) reported the following rates of K+ current inhibition in gypsy moth (the higher the rate, the more effective the Cry protein is at destroying the K+ gradient across the cell membrane) with Cry IAb protein mutated at various positions (R224A means Arg at position 224 is mutated to Ala):
| Protein | Slope of short circuit current decay |
Wild type (no mutation) | -13.8 |
| R224A | -10.2 |
| R228A | -9.6 |
| R233A | -4.2 |
| No Cry protein | 0 |
- Based on the current data in the table above, which arginine appears to be most important for the function of the Cry protein? ___________________
- You will now characterize the interactions of the arginine you selected. Type “restrict within (4.0, ArgXXX)” where XXX is the number of the arginine you selected, then click on ball+stick in the display menu. This command will hide everything except for the atoms within 4 angstroms of the arginine you selected. You may need to zoom in and center to be able to see everything well. Click on the displayed atoms to reveal their identity in the bottom left box. A comment like “Atom: OD1 327 Group: ASP 74” means that you have clicked on the delta oxygen of aspartic acid in position 74. What kind of intermolecular interaction(s) would be disrupted by changing this arginine to an alanine? _______________________________
- Write a brief explanation of why mutating your selected arginine to alanine might affect Cry protein function, and design an experiment to confirm your hypothesis.
Farmers
Read:
- “Farm-level effects of adopting genetically engineered crops,” Economic Issues in Agricultural Biotechnology, Economic Research Service/USDA, Bulletin AIB-762, p. 10–15;
- Sammons, E. et al., “Reevaluating glyphosate as a transition-state inhibitor of EPSP synthase: identification of an EPSP synthase.EPSP.glyphosate ternary complex,” Biochemistry, May 16, 1995; 34(19): 6433–40; and
- Baerson, Scott R., et al., “Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase,” Plant Physiology, July 2002; 129(3): 1265–75.
Then answer the following questions:
- What factors have encouraged farmers to use genetically modified plants?
- Under what conditions do farmers reap an economic benefit from using GM crops?
- The enzyme affected by Roundup (glyphosate) is 5-enolpyruvylshikimate-3-phosphate synthase, or EPSPS for short. Find the major pathway that utilizes this enzyme. Why is this pathway crucial for plants but not for animals?
- The crystal structure of EPSPS has been determined with and without one of the substrates, and has PDB codes of 1G6T and 1EPS, respectively. Use Protein Comparator to look at these structures (http://www.proteinexplorer.org; page down twice to boxes to input the two PDB codes, then click “Protein Comparator.” Toggle off the spinning and waters for both the top and bottom screens, and examine the structures). Does EPSPS follow the “lock and key” or “induced fit” model of enzyme-substrate binding? Explain.
- Below is the structure of glyphosate. Draw the structures of the reactants and products for the reaction EPSPS catalyzes. Which substrate has a similar structure to glyphosate? Show the structural parallels between the two structures. Why did this lead to the assumption that glyphosate is a competitive inhibitor?
- Based on the kinetic data presented in the Biochemistry paper, what type of inhibitor is glyphosate for the reverse reaction? Explain your answer.
- Describe in detail how the sequence of the resistant goosegrass EPSPS enzyme differs from the wildtype (normal) goosegrass EPSPS enzyme.
Immunologists
Read:
- Hileman, Bette, “What’s hiding in transgenic foods?” Chemical & Engineering News, Jan 7, 2002, 20–22;
- Fu, Tong-Jen, et al., “Digestibility of food allergens and nonallergenic proteins in a simulated gastric fluid and simulated intestinal fluid—A comparative study,” Journal of Agricultural & Food Chemistry, Nov. 20, 2002;50(24): 7154–60; and
- Kleter, Gijs A., et al., “Screening of transgenic proteins expressed in transgenic food crops for the presence of short amino acid sequences identical to potential, IgE-binding linear epitopes of allergens,” BMC Structural Biology, Dec. 12, 2002; 2(1): 8 (http://www.biomedcentral.com/1472-6807/2/8).
Then answer the following questions:
- What methods are used to predict whether a protein may be an allergen? What are the advantages and disadvantages of each of these models?
- Describe in detail the conditions used to test the digestibility of proteins and how digestion was evaluated. What criteria should be used in “establishing a globally used standardized assay condition”? Based on the results of this study, what should those criteria be?
- Computational methods may also help screen for potential allergens. Describe the possible algorithms that could be used for such a screening. What are the advantages and disadvantages of a long and a short reference frame? What would be the advantage of discontinuous epitope searches, and why aren’t they currently used?
- Next, you are going to test the sequence of the Cry protein that is in Starlink corn, Cry9C. You will use the computational methods described by Kleter and Peijnenburg. The sequence is shown below:
MADYLQMTDE DYTDSYINPS LSISGRDAVQ TALTVVGRIL GALGVPFSGQ IVSFYQFLLN TLWPVNDTAIW EAFMRQVEEL VNQQITEFAR NQALARLQGL GDSFNVYQRS LQNWLADRND TKNLSVVRAQ FIALDLDFVN AIPLFAVNGQ QVPLLSVYAQ AVNLHLLLLK DASLFGEGWG FTQGEISTYY DRQLELTAKY TNYCETWYNT GLDRLRGTNT ESWLRYHQFR REMTLVVLDV VALFPYYDVR LYPTGSNPQL TREVYTDPIV FNPPANVGLC RRWGTNPYNT FSELENAFIR PPHLFDRLNS LTISSNRFPV SSNFMDYWSG HTLRRSYLND SAVQEDSYGL ITTTRATINP GVDGTNRIES TAVDFRSALI GIYGVNRASF VPGGLFNGTT SPANGGCRDL YDTNDELPPD ESTGSSTHRLS HVTFFSFQTNQ AGSIANAGSV PTYVWTRRDV DLNNTITPNR ITQLPLVKAS APVSGTTVLK GPGFTGGGIL RRTTNGTFGT LRVTVNSPLTQ QYRLRVRFAST GNFSIRVLRG GVSIGDVRLG STMNRGQELT YESFFTREFT TTGPFNPPFT FTQAQEILTV NAEGVSTGGE YYIDRIEIVP VNPAREAEE
a. Search for identical sequences in allergenic proteins.
- Go to the BLAST webpage of the U.S. National Library of Medicine’s Entrez website: http://www.ncbi.nlm.nih.gov/BLAST/
- Under the “Protein BLAST” list, choose “search for short nearly exact matches”
- Paste transgenic protein sequence into the search window
- Under the “Options” list, set the following parameters:
limit by Entrez query: allergen
- Under the “Format” list, set the following parameters:
descriptions: 50
alignments: 50
- Click the “BLAST” button on the bottom of the page, and the “Format” button in the webpage that subsequently appears.
- Identify identical peptide sequences of at least six contiguous amino acids from the results by looking at the alignments (scroll down to the alignment section). Your sequence is the top, the ones that match are in the middle (+s are related but not identical aa’s), and the ones on the bottom are from the allergenic protein. You’re looking for 6 continuous letters in the middle line. Record the sequence and location of any matches in our target protein, and the name(s) and accession number(s) of any matches.
- Verify the identity of the proteins by accessing their database files (by clicking on the hyperlink) in the BLAST result list.
- Exclude from the results identical peptide sequences from proteins that are not allergens but that were retrieved by use of the query limit “allergen”, such as antibodies that react with allergens and putative proteins from open-reading-frames identified in genome projects that share similarities with allergens.
b. Carry out antigenicity prediction by constructing a hydrophilicity plot with the Hopp and Woods method [A1].
- Go to the following webpage on the Colorado State University’s website:
http://arbl.cvmbs.colostate.edu/molkit/hydropathy/index.html
- Enter the protein sequence in the box and click on the following options:
Hopp & Woods
Window size: 6
Click “plot”.
- Check if the top position of the highest peak in the plot falls within the identical sequence identified by the BLAST search. Such coincidence indicates a high probability for antigenicity of the identical peptide sequence.
Your answer to this question should include:
- The 6 aa sequence(s) in the protein that matches something in the database and the residue #s of these amino acids
- The name and length of the protein(s) in the database that matched the target protein (notice, the same protein may be in the database more than once)
- Whether the 6 aa sequence(s) might be allergenic, based on the Hopp & Woods data
Copyright © 1999–2010 by the National Center for Case Study Teaching in Science. Please see our usage guidelines, which outline our policy concerning permissible reproduction of this work.